ID: 1037662883

View in Genome Browser
Species Human (GRCh38)
Location 8:20942210-20942232
Sequence TTGGACCAAAGTGCCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037662883_1037662889 -6 Left 1037662883 8:20942210-20942232 CCAACCAAGGCACTTTGGTCCAA No data
Right 1037662889 8:20942227-20942249 GTCCAAGGCCAGGCTTCTTGGGG No data
1037662883_1037662887 -8 Left 1037662883 8:20942210-20942232 CCAACCAAGGCACTTTGGTCCAA No data
Right 1037662887 8:20942225-20942247 TGGTCCAAGGCCAGGCTTCTTGG No data
1037662883_1037662888 -7 Left 1037662883 8:20942210-20942232 CCAACCAAGGCACTTTGGTCCAA No data
Right 1037662888 8:20942226-20942248 GGTCCAAGGCCAGGCTTCTTGGG No data
1037662883_1037662892 17 Left 1037662883 8:20942210-20942232 CCAACCAAGGCACTTTGGTCCAA No data
Right 1037662892 8:20942250-20942272 TCCAAGAACCCCCAAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037662883 Original CRISPR TTGGACCAAAGTGCCTTGGT TGG (reversed) Intergenic
No off target data available for this crispr