ID: 1037662887

View in Genome Browser
Species Human (GRCh38)
Location 8:20942225-20942247
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037662883_1037662887 -8 Left 1037662883 8:20942210-20942232 CCAACCAAGGCACTTTGGTCCAA No data
Right 1037662887 8:20942225-20942247 TGGTCCAAGGCCAGGCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037662887 Original CRISPR TGGTCCAAGGCCAGGCTTCT TGG Intergenic
No off target data available for this crispr