ID: 1037662889

View in Genome Browser
Species Human (GRCh38)
Location 8:20942227-20942249
Sequence GTCCAAGGCCAGGCTTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037662883_1037662889 -6 Left 1037662883 8:20942210-20942232 CCAACCAAGGCACTTTGGTCCAA No data
Right 1037662889 8:20942227-20942249 GTCCAAGGCCAGGCTTCTTGGGG No data
1037662885_1037662889 -10 Left 1037662885 8:20942214-20942236 CCAAGGCACTTTGGTCCAAGGCC No data
Right 1037662889 8:20942227-20942249 GTCCAAGGCCAGGCTTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037662889 Original CRISPR GTCCAAGGCCAGGCTTCTTG GGG Intergenic
No off target data available for this crispr