ID: 1037662892

View in Genome Browser
Species Human (GRCh38)
Location 8:20942250-20942272
Sequence TCCAAGAACCCCCAAAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037662883_1037662892 17 Left 1037662883 8:20942210-20942232 CCAACCAAGGCACTTTGGTCCAA No data
Right 1037662892 8:20942250-20942272 TCCAAGAACCCCCAAAGTGTAGG No data
1037662885_1037662892 13 Left 1037662885 8:20942214-20942236 CCAAGGCACTTTGGTCCAAGGCC No data
Right 1037662892 8:20942250-20942272 TCCAAGAACCCCCAAAGTGTAGG No data
1037662891_1037662892 -8 Left 1037662891 8:20942235-20942257 CCAGGCTTCTTGGGGTCCAAGAA No data
Right 1037662892 8:20942250-20942272 TCCAAGAACCCCCAAAGTGTAGG No data
1037662890_1037662892 -2 Left 1037662890 8:20942229-20942251 CCAAGGCCAGGCTTCTTGGGGTC No data
Right 1037662892 8:20942250-20942272 TCCAAGAACCCCCAAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037662892 Original CRISPR TCCAAGAACCCCCAAAGTGT AGG Intergenic
No off target data available for this crispr