ID: 1037663123

View in Genome Browser
Species Human (GRCh38)
Location 8:20944021-20944043
Sequence GAATCCCCTTGGGTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037663123_1037663130 0 Left 1037663123 8:20944021-20944043 CCTGGCCTCACCCAAGGGGATTC No data
Right 1037663130 8:20944044-20944066 TAGGGAGGAATGTTTGCCTGTGG No data
1037663123_1037663133 20 Left 1037663123 8:20944021-20944043 CCTGGCCTCACCCAAGGGGATTC No data
Right 1037663133 8:20944064-20944086 TGGATGCCAGCATCTGTGCAGGG No data
1037663123_1037663132 19 Left 1037663123 8:20944021-20944043 CCTGGCCTCACCCAAGGGGATTC No data
Right 1037663132 8:20944063-20944085 GTGGATGCCAGCATCTGTGCAGG No data
1037663123_1037663134 21 Left 1037663123 8:20944021-20944043 CCTGGCCTCACCCAAGGGGATTC No data
Right 1037663134 8:20944065-20944087 GGATGCCAGCATCTGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037663123 Original CRISPR GAATCCCCTTGGGTGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr