ID: 1037666129

View in Genome Browser
Species Human (GRCh38)
Location 8:20971764-20971786
Sequence GGTTTTGCACATGCACGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037666129_1037666137 9 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666137 8:20971796-20971818 GCAACAAGCAGGGCTGGTGAAGG No data
1037666129_1037666135 -1 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666135 8:20971786-20971808 CATTAGAAAAGCAACAAGCAGGG No data
1037666129_1037666134 -2 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666134 8:20971785-20971807 CCATTAGAAAAGCAACAAGCAGG No data
1037666129_1037666140 18 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666140 8:20971805-20971827 AGGGCTGGTGAAGGAATCAGGGG No data
1037666129_1037666136 3 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666136 8:20971790-20971812 AGAAAAGCAACAAGCAGGGCTGG No data
1037666129_1037666141 22 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666141 8:20971809-20971831 CTGGTGAAGGAATCAGGGGAAGG No data
1037666129_1037666138 16 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666138 8:20971803-20971825 GCAGGGCTGGTGAAGGAATCAGG No data
1037666129_1037666139 17 Left 1037666129 8:20971764-20971786 CCCCTCCGTGCATGTGCAAAACC No data
Right 1037666139 8:20971804-20971826 CAGGGCTGGTGAAGGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037666129 Original CRISPR GGTTTTGCACATGCACGGAG GGG (reversed) Intergenic
No off target data available for this crispr