ID: 1037670814

View in Genome Browser
Species Human (GRCh38)
Location 8:21013639-21013661
Sequence TGGGCTGGCCCCCTGACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037670798_1037670814 19 Left 1037670798 8:21013597-21013619 CCTCCCTGCACCCCCCTCCTTCC No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670807_1037670814 5 Left 1037670807 8:21013611-21013633 CCTCCTTCCTCTGGATAAGGTGA No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670810_1037670814 -2 Left 1037670810 8:21013618-21013640 CCTCTGGATAAGGTGAGGTCATG No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670802_1037670814 9 Left 1037670802 8:21013607-21013629 CCCCCCTCCTTCCTCTGGATAAG No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670806_1037670814 6 Left 1037670806 8:21013610-21013632 CCCTCCTTCCTCTGGATAAGGTG No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670809_1037670814 2 Left 1037670809 8:21013614-21013636 CCTTCCTCTGGATAAGGTGAGGT No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670805_1037670814 7 Left 1037670805 8:21013609-21013631 CCCCTCCTTCCTCTGGATAAGGT No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670800_1037670814 15 Left 1037670800 8:21013601-21013623 CCTGCACCCCCCTCCTTCCTCTG No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670803_1037670814 8 Left 1037670803 8:21013608-21013630 CCCCCTCCTTCCTCTGGATAAGG No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670796_1037670814 23 Left 1037670796 8:21013593-21013615 CCTCCCTCCCTGCACCCCCCTCC No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670799_1037670814 16 Left 1037670799 8:21013600-21013622 CCCTGCACCCCCCTCCTTCCTCT No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data
1037670797_1037670814 20 Left 1037670797 8:21013596-21013618 CCCTCCCTGCACCCCCCTCCTTC No data
Right 1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037670814 Original CRISPR TGGGCTGGCCCCCTGACAAC AGG Intergenic
No off target data available for this crispr