ID: 1037671055

View in Genome Browser
Species Human (GRCh38)
Location 8:21015753-21015775
Sequence AGGACCACACAGGTGACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037671050_1037671055 1 Left 1037671050 8:21015729-21015751 CCAGCAGGAAAAGGCAGGTGGGC No data
Right 1037671055 8:21015753-21015775 AGGACCACACAGGTGACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037671055 Original CRISPR AGGACCACACAGGTGACCAA GGG Intergenic