ID: 1037671055 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:21015753-21015775 |
| Sequence | AGGACCACACAGGTGACCAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037671050_1037671055 | 1 | Left | 1037671050 | 8:21015729-21015751 | CCAGCAGGAAAAGGCAGGTGGGC | No data | ||
| Right | 1037671055 | 8:21015753-21015775 | AGGACCACACAGGTGACCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037671055 | Original CRISPR | AGGACCACACAGGTGACCAA GGG | Intergenic | ||