ID: 1037672266

View in Genome Browser
Species Human (GRCh38)
Location 8:21025209-21025231
Sequence TGGGTCTACCCTAAAATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037672266_1037672275 27 Left 1037672266 8:21025209-21025231 CCCTAGATTTTAGGGTAGACCCA No data
Right 1037672275 8:21025259-21025281 AGTAAGTGGTGTTTACTCACAGG No data
1037672266_1037672274 13 Left 1037672266 8:21025209-21025231 CCCTAGATTTTAGGGTAGACCCA No data
Right 1037672274 8:21025245-21025267 TGAAATCAAGATGAAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037672266 Original CRISPR TGGGTCTACCCTAAAATCTA GGG (reversed) Intergenic
No off target data available for this crispr