ID: 1037672267

View in Genome Browser
Species Human (GRCh38)
Location 8:21025210-21025232
Sequence CTGGGTCTACCCTAAAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037672267_1037672274 12 Left 1037672267 8:21025210-21025232 CCTAGATTTTAGGGTAGACCCAG No data
Right 1037672274 8:21025245-21025267 TGAAATCAAGATGAAGTAAGTGG No data
1037672267_1037672275 26 Left 1037672267 8:21025210-21025232 CCTAGATTTTAGGGTAGACCCAG No data
Right 1037672275 8:21025259-21025281 AGTAAGTGGTGTTTACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037672267 Original CRISPR CTGGGTCTACCCTAAAATCT AGG (reversed) Intergenic
No off target data available for this crispr