ID: 1037672272

View in Genome Browser
Species Human (GRCh38)
Location 8:21025229-21025251
Sequence GATTTCACGGTCTCCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037672272_1037672276 17 Left 1037672272 8:21025229-21025251 CCAGGATGGGAGACCGTGAAATC No data
Right 1037672276 8:21025269-21025291 GTTTACTCACAGGCACAAAGTGG No data
1037672272_1037672275 7 Left 1037672272 8:21025229-21025251 CCAGGATGGGAGACCGTGAAATC No data
Right 1037672275 8:21025259-21025281 AGTAAGTGGTGTTTACTCACAGG No data
1037672272_1037672277 30 Left 1037672272 8:21025229-21025251 CCAGGATGGGAGACCGTGAAATC No data
Right 1037672277 8:21025282-21025304 CACAAAGTGGCAATCTCACATGG No data
1037672272_1037672274 -7 Left 1037672272 8:21025229-21025251 CCAGGATGGGAGACCGTGAAATC No data
Right 1037672274 8:21025245-21025267 TGAAATCAAGATGAAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037672272 Original CRISPR GATTTCACGGTCTCCCATCC TGG (reversed) Intergenic
No off target data available for this crispr