ID: 1037672274

View in Genome Browser
Species Human (GRCh38)
Location 8:21025245-21025267
Sequence TGAAATCAAGATGAAGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037672271_1037672274 -6 Left 1037672271 8:21025228-21025250 CCCAGGATGGGAGACCGTGAAAT No data
Right 1037672274 8:21025245-21025267 TGAAATCAAGATGAAGTAAGTGG No data
1037672267_1037672274 12 Left 1037672267 8:21025210-21025232 CCTAGATTTTAGGGTAGACCCAG No data
Right 1037672274 8:21025245-21025267 TGAAATCAAGATGAAGTAAGTGG No data
1037672272_1037672274 -7 Left 1037672272 8:21025229-21025251 CCAGGATGGGAGACCGTGAAATC No data
Right 1037672274 8:21025245-21025267 TGAAATCAAGATGAAGTAAGTGG No data
1037672266_1037672274 13 Left 1037672266 8:21025209-21025231 CCCTAGATTTTAGGGTAGACCCA No data
Right 1037672274 8:21025245-21025267 TGAAATCAAGATGAAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037672274 Original CRISPR TGAAATCAAGATGAAGTAAG TGG Intergenic
No off target data available for this crispr