ID: 1037672276

View in Genome Browser
Species Human (GRCh38)
Location 8:21025269-21025291
Sequence GTTTACTCACAGGCACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037672273_1037672276 4 Left 1037672273 8:21025242-21025264 CCGTGAAATCAAGATGAAGTAAG No data
Right 1037672276 8:21025269-21025291 GTTTACTCACAGGCACAAAGTGG No data
1037672271_1037672276 18 Left 1037672271 8:21025228-21025250 CCCAGGATGGGAGACCGTGAAAT No data
Right 1037672276 8:21025269-21025291 GTTTACTCACAGGCACAAAGTGG No data
1037672272_1037672276 17 Left 1037672272 8:21025229-21025251 CCAGGATGGGAGACCGTGAAATC No data
Right 1037672276 8:21025269-21025291 GTTTACTCACAGGCACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037672276 Original CRISPR GTTTACTCACAGGCACAAAG TGG Intergenic
No off target data available for this crispr