ID: 1037675275

View in Genome Browser
Species Human (GRCh38)
Location 8:21045616-21045638
Sequence GTGAGCTCCAGCACCCGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037675275_1037675278 -8 Left 1037675275 8:21045616-21045638 CCAGTCCGGGTGCTGGAGCTCAC No data
Right 1037675278 8:21045631-21045653 GAGCTCACATATACCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037675275 Original CRISPR GTGAGCTCCAGCACCCGGAC TGG (reversed) Intergenic
No off target data available for this crispr