ID: 1037678147

View in Genome Browser
Species Human (GRCh38)
Location 8:21069974-21069996
Sequence GTGGACTAGCCAGCTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037678139_1037678147 23 Left 1037678139 8:21069928-21069950 CCATCAACACTGAACTGGCCAAA No data
Right 1037678147 8:21069974-21069996 GTGGACTAGCCAGCTAACACTGG No data
1037678143_1037678147 5 Left 1037678143 8:21069946-21069968 CCAAAGTCCATATCTTGGGGTAT No data
Right 1037678147 8:21069974-21069996 GTGGACTAGCCAGCTAACACTGG No data
1037678144_1037678147 -2 Left 1037678144 8:21069953-21069975 CCATATCTTGGGGTATTGCCAGT No data
Right 1037678147 8:21069974-21069996 GTGGACTAGCCAGCTAACACTGG No data
1037678138_1037678147 24 Left 1037678138 8:21069927-21069949 CCCATCAACACTGAACTGGCCAA No data
Right 1037678147 8:21069974-21069996 GTGGACTAGCCAGCTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037678147 Original CRISPR GTGGACTAGCCAGCTAACAC TGG Intergenic
No off target data available for this crispr