ID: 1037684811

View in Genome Browser
Species Human (GRCh38)
Location 8:21129746-21129768
Sequence CCAGATTAGCAGCTAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037684811_1037684821 29 Left 1037684811 8:21129746-21129768 CCAGGCACTAGCTGCTAATCTGG No data
Right 1037684821 8:21129798-21129820 AGAACTGGCAAGAGTAAGGCTGG No data
1037684811_1037684817 14 Left 1037684811 8:21129746-21129768 CCAGGCACTAGCTGCTAATCTGG No data
Right 1037684817 8:21129783-21129805 ACTCTCTCCCTTGGGAGAACTGG No data
1037684811_1037684816 6 Left 1037684811 8:21129746-21129768 CCAGGCACTAGCTGCTAATCTGG No data
Right 1037684816 8:21129775-21129797 AGGTCACAACTCTCTCCCTTGGG No data
1037684811_1037684815 5 Left 1037684811 8:21129746-21129768 CCAGGCACTAGCTGCTAATCTGG No data
Right 1037684815 8:21129774-21129796 AAGGTCACAACTCTCTCCCTTGG No data
1037684811_1037684820 25 Left 1037684811 8:21129746-21129768 CCAGGCACTAGCTGCTAATCTGG No data
Right 1037684820 8:21129794-21129816 TGGGAGAACTGGCAAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037684811 Original CRISPR CCAGATTAGCAGCTAGTGCC TGG (reversed) Intergenic
No off target data available for this crispr