ID: 1037687959

View in Genome Browser
Species Human (GRCh38)
Location 8:21159533-21159555
Sequence CAGAATAAAGAGAGGGAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037687951_1037687959 18 Left 1037687951 8:21159492-21159514 CCTCTTCCAGAAAGGAGGCCTTT No data
Right 1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG No data
1037687952_1037687959 12 Left 1037687952 8:21159498-21159520 CCAGAAAGGAGGCCTTTGAAGAA No data
Right 1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG No data
1037687954_1037687959 0 Left 1037687954 8:21159510-21159532 CCTTTGAAGAAAAGGCGAGTGAT No data
Right 1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037687959 Original CRISPR CAGAATAAAGAGAGGGAGCG GGG Intergenic
No off target data available for this crispr