ID: 1037688805

View in Genome Browser
Species Human (GRCh38)
Location 8:21165823-21165845
Sequence CCTAAGAGCTTCCAGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037688805_1037688813 10 Left 1037688805 8:21165823-21165845 CCTGGCTTCTGGAAGCTCTTAGG No data
Right 1037688813 8:21165856-21165878 TCATCAGATGGGTTCTTTTGGGG No data
1037688805_1037688812 9 Left 1037688805 8:21165823-21165845 CCTGGCTTCTGGAAGCTCTTAGG No data
Right 1037688812 8:21165855-21165877 TTCATCAGATGGGTTCTTTTGGG No data
1037688805_1037688809 -2 Left 1037688805 8:21165823-21165845 CCTGGCTTCTGGAAGCTCTTAGG No data
Right 1037688809 8:21165844-21165866 GGAGGGAAATGTTCATCAGATGG No data
1037688805_1037688811 8 Left 1037688805 8:21165823-21165845 CCTGGCTTCTGGAAGCTCTTAGG No data
Right 1037688811 8:21165854-21165876 GTTCATCAGATGGGTTCTTTTGG No data
1037688805_1037688810 -1 Left 1037688805 8:21165823-21165845 CCTGGCTTCTGGAAGCTCTTAGG No data
Right 1037688810 8:21165845-21165867 GAGGGAAATGTTCATCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037688805 Original CRISPR CCTAAGAGCTTCCAGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr