ID: 1037689435

View in Genome Browser
Species Human (GRCh38)
Location 8:21170186-21170208
Sequence GAGGGAAAAGGGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037689435_1037689445 3 Left 1037689435 8:21170186-21170208 CCATCCTCCTTCCCTTTTCCCTC No data
Right 1037689445 8:21170212-21170234 GTCTGGCTTTCCCTCCCTCTGGG No data
1037689435_1037689444 2 Left 1037689435 8:21170186-21170208 CCATCCTCCTTCCCTTTTCCCTC No data
Right 1037689444 8:21170211-21170233 TGTCTGGCTTTCCCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037689435 Original CRISPR GAGGGAAAAGGGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr