ID: 1037689733

View in Genome Browser
Species Human (GRCh38)
Location 8:21171906-21171928
Sequence CCCGCTGCACAGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037689733_1037689739 -1 Left 1037689733 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG No data
Right 1037689739 8:21171928-21171950 GCATCACCATGCCAGCTCCCAGG No data
1037689733_1037689740 0 Left 1037689733 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG No data
Right 1037689740 8:21171929-21171951 CATCACCATGCCAGCTCCCAGGG No data
1037689733_1037689741 1 Left 1037689733 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG No data
Right 1037689741 8:21171930-21171952 ATCACCATGCCAGCTCCCAGGGG No data
1037689733_1037689742 2 Left 1037689733 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG No data
Right 1037689742 8:21171931-21171953 TCACCATGCCAGCTCCCAGGGGG No data
1037689733_1037689745 14 Left 1037689733 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG No data
Right 1037689745 8:21171943-21171965 CTCCCAGGGGGTACACACTGTGG No data
1037689733_1037689748 22 Left 1037689733 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG No data
Right 1037689748 8:21171951-21171973 GGGTACACACTGTGGTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037689733 Original CRISPR CCCGCTGCACAGAGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr