ID: 1037690500

View in Genome Browser
Species Human (GRCh38)
Location 8:21177648-21177670
Sequence CACATTTTCTCCCCATAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037690500_1037690501 -6 Left 1037690500 8:21177648-21177670 CCAGTTTATGGGGAGAAAATGTG No data
Right 1037690501 8:21177665-21177687 AATGTGCTGCTTGTAGTCTCCGG No data
1037690500_1037690502 -5 Left 1037690500 8:21177648-21177670 CCAGTTTATGGGGAGAAAATGTG No data
Right 1037690502 8:21177666-21177688 ATGTGCTGCTTGTAGTCTCCGGG No data
1037690500_1037690505 29 Left 1037690500 8:21177648-21177670 CCAGTTTATGGGGAGAAAATGTG No data
Right 1037690505 8:21177700-21177722 TAGTTCATTTCCATCTGCGTGGG No data
1037690500_1037690504 28 Left 1037690500 8:21177648-21177670 CCAGTTTATGGGGAGAAAATGTG No data
Right 1037690504 8:21177699-21177721 CTAGTTCATTTCCATCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037690500 Original CRISPR CACATTTTCTCCCCATAAAC TGG (reversed) Intergenic
No off target data available for this crispr