ID: 1037690502

View in Genome Browser
Species Human (GRCh38)
Location 8:21177666-21177688
Sequence ATGTGCTGCTTGTAGTCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037690500_1037690502 -5 Left 1037690500 8:21177648-21177670 CCAGTTTATGGGGAGAAAATGTG No data
Right 1037690502 8:21177666-21177688 ATGTGCTGCTTGTAGTCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037690502 Original CRISPR ATGTGCTGCTTGTAGTCTCC GGG Intergenic
No off target data available for this crispr