ID: 1037692361

View in Genome Browser
Species Human (GRCh38)
Location 8:21192887-21192909
Sequence GAGCCACATTGTCCCTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037692361_1037692366 0 Left 1037692361 8:21192887-21192909 CCCCACAAGGGACAATGTGGCTC No data
Right 1037692366 8:21192910-21192932 GTGGAGCAGAGCAGCAGGAATGG No data
1037692361_1037692372 26 Left 1037692361 8:21192887-21192909 CCCCACAAGGGACAATGTGGCTC No data
Right 1037692372 8:21192936-21192958 CCTGAGGGACCTTAGAGGTCAGG No data
1037692361_1037692367 3 Left 1037692361 8:21192887-21192909 CCCCACAAGGGACAATGTGGCTC No data
Right 1037692367 8:21192913-21192935 GAGCAGAGCAGCAGGAATGGTGG No data
1037692361_1037692365 -5 Left 1037692361 8:21192887-21192909 CCCCACAAGGGACAATGTGGCTC No data
Right 1037692365 8:21192905-21192927 GGCTCGTGGAGCAGAGCAGCAGG No data
1037692361_1037692369 11 Left 1037692361 8:21192887-21192909 CCCCACAAGGGACAATGTGGCTC No data
Right 1037692369 8:21192921-21192943 CAGCAGGAATGGTGGCCTGAGGG No data
1037692361_1037692368 10 Left 1037692361 8:21192887-21192909 CCCCACAAGGGACAATGTGGCTC No data
Right 1037692368 8:21192920-21192942 GCAGCAGGAATGGTGGCCTGAGG No data
1037692361_1037692370 21 Left 1037692361 8:21192887-21192909 CCCCACAAGGGACAATGTGGCTC No data
Right 1037692370 8:21192931-21192953 GGTGGCCTGAGGGACCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037692361 Original CRISPR GAGCCACATTGTCCCTTGTG GGG (reversed) Intergenic
No off target data available for this crispr