ID: 1037693784

View in Genome Browser
Species Human (GRCh38)
Location 8:21206400-21206422
Sequence GGTGGAATTCACCATGCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037693781_1037693784 -1 Left 1037693781 8:21206378-21206400 CCTTTCAGGTTGAAAAGATGAAG No data
Right 1037693784 8:21206400-21206422 GGTGGAATTCACCATGCGAGAGG No data
1037693779_1037693784 17 Left 1037693779 8:21206360-21206382 CCAACAACGAAAAAAAATCCTTT No data
Right 1037693784 8:21206400-21206422 GGTGGAATTCACCATGCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037693784 Original CRISPR GGTGGAATTCACCATGCGAG AGG Intergenic
No off target data available for this crispr