ID: 1037693991

View in Genome Browser
Species Human (GRCh38)
Location 8:21207899-21207921
Sequence CTGTGGGGGTGGGGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037693991_1037694003 -4 Left 1037693991 8:21207899-21207921 CCCTCTACCCCCCACCCCCACAG No data
Right 1037694003 8:21207918-21207940 ACAGCCAGCTTCCCCTCTGAGGG No data
1037693991_1037694002 -5 Left 1037693991 8:21207899-21207921 CCCTCTACCCCCCACCCCCACAG No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037693991 Original CRISPR CTGTGGGGGTGGGGGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr