ID: 1037694002

View in Genome Browser
Species Human (GRCh38)
Location 8:21207917-21207939
Sequence CACAGCCAGCTTCCCCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037693986_1037694002 8 Left 1037693986 8:21207886-21207908 CCACCACCGCCCACCCTCTACCC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693985_1037694002 17 Left 1037693985 8:21207877-21207899 CCAGCACTACCACCACCGCCCAC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693988_1037694002 2 Left 1037693988 8:21207892-21207914 CCGCCCACCCTCTACCCCCCACC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693991_1037694002 -5 Left 1037693991 8:21207899-21207921 CCCTCTACCCCCCACCCCCACAG No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693990_1037694002 -2 Left 1037693990 8:21207896-21207918 CCACCCTCTACCCCCCACCCCCA No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693987_1037694002 5 Left 1037693987 8:21207889-21207911 CCACCGCCCACCCTCTACCCCCC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693989_1037694002 -1 Left 1037693989 8:21207895-21207917 CCCACCCTCTACCCCCCACCCCC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693984_1037694002 18 Left 1037693984 8:21207876-21207898 CCCAGCACTACCACCACCGCCCA No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693982_1037694002 22 Left 1037693982 8:21207872-21207894 CCCTCCCAGCACTACCACCACCG No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693981_1037694002 26 Left 1037693981 8:21207868-21207890 CCTTCCCTCCCAGCACTACCACC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693992_1037694002 -6 Left 1037693992 8:21207900-21207922 CCTCTACCCCCCACCCCCACAGC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data
1037693983_1037694002 21 Left 1037693983 8:21207873-21207895 CCTCCCAGCACTACCACCACCGC No data
Right 1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037694002 Original CRISPR CACAGCCAGCTTCCCCTCTG AGG Intergenic
No off target data available for this crispr