ID: 1037694813

View in Genome Browser
Species Human (GRCh38)
Location 8:21214279-21214301
Sequence TGGTGTTTCTTGCACTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037694808_1037694813 14 Left 1037694808 8:21214242-21214264 CCAAGAATATGGAATTATTTACC No data
Right 1037694813 8:21214279-21214301 TGGTGTTTCTTGCACTCCAAGGG No data
1037694807_1037694813 18 Left 1037694807 8:21214238-21214260 CCAGCCAAGAATATGGAATTATT No data
Right 1037694813 8:21214279-21214301 TGGTGTTTCTTGCACTCCAAGGG No data
1037694810_1037694813 -7 Left 1037694810 8:21214263-21214285 CCTACCACTTACTTACTGGTGTT No data
Right 1037694813 8:21214279-21214301 TGGTGTTTCTTGCACTCCAAGGG No data
1037694805_1037694813 27 Left 1037694805 8:21214229-21214251 CCATTGCAACCAGCCAAGAATAT No data
Right 1037694813 8:21214279-21214301 TGGTGTTTCTTGCACTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037694813 Original CRISPR TGGTGTTTCTTGCACTCCAA GGG Intergenic
No off target data available for this crispr