ID: 1037699380

View in Genome Browser
Species Human (GRCh38)
Location 8:21260782-21260804
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699380_1037699382 -4 Left 1037699380 8:21260782-21260804 CCCACTACACACTTATTACAATG No data
Right 1037699382 8:21260801-21260823 AATGTTTAAAATAAAAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699380 Original CRISPR CATTGTAATAAGTGTGTAGT GGG (reversed) Intergenic
No off target data available for this crispr