ID: 1037699755

View in Genome Browser
Species Human (GRCh38)
Location 8:21263674-21263696
Sequence CACCCAGGAGTTACTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699755_1037699760 -3 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699760 8:21263694-21263716 GTGGGCCTATGAGCGAGAACAGG No data
1037699755_1037699761 -2 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699761 8:21263695-21263717 TGGGCCTATGAGCGAGAACAGGG No data
1037699755_1037699765 24 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699765 8:21263721-21263743 GGGCCATGCAATCTCTCCTGTGG No data
1037699755_1037699766 25 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699766 8:21263722-21263744 GGCCATGCAATCTCTCCTGTGGG No data
1037699755_1037699763 3 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699763 8:21263700-21263722 CTATGAGCGAGAACAGGGTCTGG No data
1037699755_1037699764 4 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699764 8:21263701-21263723 TATGAGCGAGAACAGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699755 Original CRISPR CACCCAGGAGTTACTCTGAT GGG (reversed) Intergenic