ID: 1037699759

View in Genome Browser
Species Human (GRCh38)
Location 8:21263689-21263711
Sequence TCTCGCTCATAGGCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699759_1037699769 23 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699769 8:21263735-21263757 CTCCTGTGGGCATGTGGCAGCGG No data
1037699759_1037699770 24 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699770 8:21263736-21263758 TCCTGTGGGCATGTGGCAGCGGG No data
1037699759_1037699773 26 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699773 8:21263738-21263760 CTGTGGGCATGTGGCAGCGGGGG No data
1037699759_1037699766 10 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699766 8:21263722-21263744 GGCCATGCAATCTCTCCTGTGGG No data
1037699759_1037699765 9 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699765 8:21263721-21263743 GGGCCATGCAATCTCTCCTGTGG No data
1037699759_1037699772 25 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699772 8:21263737-21263759 CCTGTGGGCATGTGGCAGCGGGG No data
1037699759_1037699768 17 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699768 8:21263729-21263751 CAATCTCTCCTGTGGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699759 Original CRISPR TCTCGCTCATAGGCCCACCC AGG (reversed) Intergenic