ID: 1037699760

View in Genome Browser
Species Human (GRCh38)
Location 8:21263694-21263716
Sequence GTGGGCCTATGAGCGAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699755_1037699760 -3 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699760 8:21263694-21263716 GTGGGCCTATGAGCGAGAACAGG No data
1037699756_1037699760 -4 Left 1037699756 8:21263675-21263697 CCATCAGAGTAACTCCTGGGTGG No data
Right 1037699760 8:21263694-21263716 GTGGGCCTATGAGCGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699760 Original CRISPR GTGGGCCTATGAGCGAGAAC AGG Intergenic