ID: 1037699761

View in Genome Browser
Species Human (GRCh38)
Location 8:21263695-21263717
Sequence TGGGCCTATGAGCGAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699756_1037699761 -3 Left 1037699756 8:21263675-21263697 CCATCAGAGTAACTCCTGGGTGG No data
Right 1037699761 8:21263695-21263717 TGGGCCTATGAGCGAGAACAGGG No data
1037699755_1037699761 -2 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699761 8:21263695-21263717 TGGGCCTATGAGCGAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699761 Original CRISPR TGGGCCTATGAGCGAGAACA GGG Intergenic
No off target data available for this crispr