ID: 1037699763

View in Genome Browser
Species Human (GRCh38)
Location 8:21263700-21263722
Sequence CTATGAGCGAGAACAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699756_1037699763 2 Left 1037699756 8:21263675-21263697 CCATCAGAGTAACTCCTGGGTGG No data
Right 1037699763 8:21263700-21263722 CTATGAGCGAGAACAGGGTCTGG No data
1037699755_1037699763 3 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699763 8:21263700-21263722 CTATGAGCGAGAACAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699763 Original CRISPR CTATGAGCGAGAACAGGGTC TGG Intergenic