ID: 1037699766

View in Genome Browser
Species Human (GRCh38)
Location 8:21263722-21263744
Sequence GGCCATGCAATCTCTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699759_1037699766 10 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699766 8:21263722-21263744 GGCCATGCAATCTCTCCTGTGGG No data
1037699756_1037699766 24 Left 1037699756 8:21263675-21263697 CCATCAGAGTAACTCCTGGGTGG No data
Right 1037699766 8:21263722-21263744 GGCCATGCAATCTCTCCTGTGGG No data
1037699755_1037699766 25 Left 1037699755 8:21263674-21263696 CCCATCAGAGTAACTCCTGGGTG No data
Right 1037699766 8:21263722-21263744 GGCCATGCAATCTCTCCTGTGGG No data
1037699762_1037699766 0 Left 1037699762 8:21263699-21263721 CCTATGAGCGAGAACAGGGTCTG No data
Right 1037699766 8:21263722-21263744 GGCCATGCAATCTCTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699766 Original CRISPR GGCCATGCAATCTCTCCTGT GGG Intergenic
No off target data available for this crispr