ID: 1037699767

View in Genome Browser
Species Human (GRCh38)
Location 8:21263724-21263746
Sequence TGCCCACAGGAGAGATTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699767_1037699773 -9 Left 1037699767 8:21263724-21263746 CCATGCAATCTCTCCTGTGGGCA No data
Right 1037699773 8:21263738-21263760 CTGTGGGCATGTGGCAGCGGGGG No data
1037699767_1037699778 28 Left 1037699767 8:21263724-21263746 CCATGCAATCTCTCCTGTGGGCA No data
Right 1037699778 8:21263775-21263797 TCTGCACCCAGACCTGTCGAAGG No data
1037699767_1037699772 -10 Left 1037699767 8:21263724-21263746 CCATGCAATCTCTCCTGTGGGCA No data
Right 1037699772 8:21263737-21263759 CCTGTGGGCATGTGGCAGCGGGG 0: 1
1: 1
2: 2
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699767 Original CRISPR TGCCCACAGGAGAGATTGCA TGG (reversed) Intergenic