ID: 1037699768

View in Genome Browser
Species Human (GRCh38)
Location 8:21263729-21263751
Sequence CAATCTCTCCTGTGGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699759_1037699768 17 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699768 8:21263729-21263751 CAATCTCTCCTGTGGGCATGTGG No data
1037699762_1037699768 7 Left 1037699762 8:21263699-21263721 CCTATGAGCGAGAACAGGGTCTG No data
Right 1037699768 8:21263729-21263751 CAATCTCTCCTGTGGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699768 Original CRISPR CAATCTCTCCTGTGGGCATG TGG Intergenic