ID: 1037699769

View in Genome Browser
Species Human (GRCh38)
Location 8:21263735-21263757
Sequence CTCCTGTGGGCATGTGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037699762_1037699769 13 Left 1037699762 8:21263699-21263721 CCTATGAGCGAGAACAGGGTCTG No data
Right 1037699769 8:21263735-21263757 CTCCTGTGGGCATGTGGCAGCGG No data
1037699759_1037699769 23 Left 1037699759 8:21263689-21263711 CCTGGGTGGGCCTATGAGCGAGA No data
Right 1037699769 8:21263735-21263757 CTCCTGTGGGCATGTGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037699769 Original CRISPR CTCCTGTGGGCATGTGGCAG CGG Intergenic