ID: 1037703843

View in Genome Browser
Species Human (GRCh38)
Location 8:21298438-21298460
Sequence GGGGAGAAGCAGTATCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037703843_1037703855 27 Left 1037703843 8:21298438-21298460 CCCTCCTGATACTGCTTCTCCCC No data
Right 1037703855 8:21298488-21298510 GTGACTTGAGGAGTTATTTAGGG No data
1037703843_1037703853 15 Left 1037703843 8:21298438-21298460 CCCTCCTGATACTGCTTCTCCCC No data
Right 1037703853 8:21298476-21298498 GAAGGTGACAGGGTGACTTGAGG No data
1037703843_1037703852 5 Left 1037703843 8:21298438-21298460 CCCTCCTGATACTGCTTCTCCCC No data
Right 1037703852 8:21298466-21298488 AAGGACAGAAGAAGGTGACAGGG No data
1037703843_1037703851 4 Left 1037703843 8:21298438-21298460 CCCTCCTGATACTGCTTCTCCCC No data
Right 1037703851 8:21298465-21298487 TAAGGACAGAAGAAGGTGACAGG No data
1037703843_1037703849 -3 Left 1037703843 8:21298438-21298460 CCCTCCTGATACTGCTTCTCCCC No data
Right 1037703849 8:21298458-21298480 CCCAGCGTAAGGACAGAAGAAGG No data
1037703843_1037703856 28 Left 1037703843 8:21298438-21298460 CCCTCCTGATACTGCTTCTCCCC No data
Right 1037703856 8:21298489-21298511 TGACTTGAGGAGTTATTTAGGGG No data
1037703843_1037703854 26 Left 1037703843 8:21298438-21298460 CCCTCCTGATACTGCTTCTCCCC No data
Right 1037703854 8:21298487-21298509 GGTGACTTGAGGAGTTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037703843 Original CRISPR GGGGAGAAGCAGTATCAGGA GGG (reversed) Intergenic
No off target data available for this crispr