ID: 1037704646

View in Genome Browser
Species Human (GRCh38)
Location 8:21309071-21309093
Sequence CCTACTTTACCGTGGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037704646_1037704656 22 Left 1037704646 8:21309071-21309093 CCACTGTGCCACGGTAAAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1037704656 8:21309116-21309138 TCATCCCCTGCTGCCCCTGAGGG 0: 1
1: 0
2: 2
3: 21
4: 272
1037704646_1037704657 23 Left 1037704646 8:21309071-21309093 CCACTGTGCCACGGTAAAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1037704657 8:21309117-21309139 CATCCCCTGCTGCCCCTGAGGGG 0: 1
1: 0
2: 0
3: 22
4: 311
1037704646_1037704655 21 Left 1037704646 8:21309071-21309093 CCACTGTGCCACGGTAAAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1037704655 8:21309115-21309137 CTCATCCCCTGCTGCCCCTGAGG 0: 1
1: 0
2: 4
3: 46
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037704646 Original CRISPR CCTACTTTACCGTGGCACAG TGG (reversed) Intergenic
907406284 1:54255419-54255441 CCTGCTTTGCCGTGGCACATAGG - Intronic
908140914 1:61183820-61183842 CCCACTTTACCATGTCACGGTGG - Intronic
920804984 1:209224539-209224561 CATTCTTTACCCTGGAACAGTGG - Intergenic
921877753 1:220218295-220218317 CCAACTTTACCATGGCAAACTGG - Intronic
1074988547 10:118680324-118680346 CCTACTTAACTGTGGGGCAGGGG + Exonic
1076380232 10:130020334-130020356 TCTACTCTACCGTGGCAAGGTGG - Intergenic
1077410169 11:2400166-2400188 CCCCCTTCACCGTGGCCCAGCGG + Intergenic
1085974193 11:81632905-81632927 CCTACTTGTACATGGCACAGTGG + Intergenic
1089274613 11:117326196-117326218 CCTACTTGAGCCAGGCACAGTGG - Intronic
1091397483 12:162977-162999 CCTCATTTACTGTGGCTCAGTGG + Intronic
1091436350 12:476044-476066 CTTCCTTTACCATGGCATAGTGG + Intronic
1102804166 12:115764612-115764634 ACTTCTTTTCCATGGCACAGTGG - Intergenic
1103768866 12:123304216-123304238 CTTACTTTAGCTGGGCACAGTGG - Intronic
1120959699 14:90113601-90113623 CTTACATTACCATGGCACATGGG - Intronic
1123817435 15:23994269-23994291 GCCACTTTTCCGTGGCACATGGG - Intergenic
1132049594 15:98596111-98596133 TCTCCTTTCTCGTGGCACAGTGG - Intergenic
1133245554 16:4446529-4446551 CTTACTTTAGCCAGGCACAGTGG - Intronic
1133740255 16:8645908-8645930 TCTATTTTACTGTGGCAGAGAGG - Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1144735726 17:17554268-17554290 CCTTGTTTACCGAGGGACAGAGG - Intronic
1147398140 17:40161262-40161284 CCTATTTTGGCCTGGCACAGTGG - Intronic
1147728292 17:42580572-42580594 TCTACATTACCTTGGCCCAGGGG - Exonic
1149705402 17:58690451-58690473 ACTACTTTGGCCTGGCACAGTGG - Intronic
1150422930 17:65055588-65055610 CCTACCTGACCGTGACACTGGGG + Intronic
1152205026 17:78970046-78970068 CCTCCCAGACCGTGGCACAGCGG + Intergenic
1155123261 18:22843988-22844010 CCTCATTTACCTTGGCACTGAGG - Intronic
1162395479 19:10416247-10416269 CTTACTTTACCTTGGCACCCAGG - Intronic
930005805 2:46895874-46895896 CCTCCTTTACCCTGCCAGAGGGG - Intergenic
936162142 2:110091918-110091940 CTGACTTTACCGTGACTCAGCGG - Intronic
936182520 2:110279436-110279458 CTGACTTTACCGTGACTCAGCGG + Intergenic
943610960 2:190034461-190034483 CCTACTTTTCCCTGGAACACAGG - Intronic
1172919870 20:38472593-38472615 CCTACCTCATCGCGGCACAGAGG - Intergenic
1179161793 21:38905449-38905471 GCCACTTTTCCGTGGCACAGGGG - Intergenic
1179843737 21:44095523-44095545 CATACTTTAGCCGGGCACAGTGG - Intronic
1182385259 22:29933856-29933878 CCTACTTTAGCCAGGCACAATGG - Intronic
1183564715 22:38605575-38605597 ACTGCTTTAGCGGGGCACAGTGG - Intronic
1184302448 22:43569615-43569637 TCTGCCTTAGCGTGGCACAGGGG + Intronic
951296776 3:20946807-20946829 CCTACTTGAGGGTGGAACAGGGG - Intergenic
960547162 3:118928655-118928677 CCTACCCTACCGTGGAACCGGGG + Exonic
962891470 3:139676681-139676703 CCCACTTTACCCTGGCTCTGAGG - Intronic
973999092 4:56492837-56492859 CCTTCTTTAGCCTGGCATAGTGG + Intronic
976311453 4:83617158-83617180 TCTACTTTACTGTTACACAGAGG + Intergenic
987062609 5:14257017-14257039 CCCACTCTACTTTGGCACAGAGG - Intronic
991651837 5:68863516-68863538 CCTGCTTTTCCATGCCACAGAGG + Intergenic
995657778 5:114446294-114446316 CCTATTTTACTTTGGCAAAGAGG + Intronic
1011083524 6:83513969-83513991 GCTACTTTACCTTAGCACTGAGG + Intronic
1011459977 6:87592690-87592712 GCTACTTTATAGTTGCACAGCGG + Intronic
1012261243 6:97090008-97090030 CCTATTTTAGTGTGGCAAAGAGG + Intronic
1019723627 7:2588280-2588302 CCTACTTTGCAGTCGCATAGGGG - Intronic
1022123819 7:27336540-27336562 CCTGCTTTAGCCAGGCACAGTGG + Intergenic
1024449403 7:49521969-49521991 CCTAGGTTACCCTGGCACAGAGG + Intergenic
1030146832 7:106365598-106365620 CCAACTTTACCATGGCTTAGAGG + Intergenic
1034785387 7:153921581-153921603 CCCTCTTTACAGTGGCACTGTGG - Intronic
1037676872 8:21058760-21058782 CCTACTTTTCCCTGGGAGAGTGG - Intergenic
1037704646 8:21309071-21309093 CCTACTTTACCGTGGCACAGTGG - Intergenic
1039464812 8:37777326-37777348 TCTACCTGACCGTGGCACATTGG + Intronic
1049479062 8:142811360-142811382 CCCACATTCCCCTGGCACAGGGG - Intergenic
1190385863 X:49881697-49881719 CCTACTTGACCATGGCCCATGGG + Exonic