ID: 1037706406

View in Genome Browser
Species Human (GRCh38)
Location 8:21319122-21319144
Sequence ATTGTCCTCTACTCTCCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037706406_1037706415 30 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706415 8:21319175-21319197 GTGGGGGCCAGACATATCAGTGG No data
1037706406_1037706409 -5 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706409 8:21319140-21319162 ACAATGCTTTCACCTTCTCTGGG No data
1037706406_1037706411 11 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706411 8:21319156-21319178 CTCTGGGCTCTAGAACAGTGTGG No data
1037706406_1037706412 12 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706412 8:21319157-21319179 TCTGGGCTCTAGAACAGTGTGGG No data
1037706406_1037706408 -6 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706408 8:21319139-21319161 GACAATGCTTTCACCTTCTCTGG No data
1037706406_1037706414 14 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706414 8:21319159-21319181 TGGGCTCTAGAACAGTGTGGGGG No data
1037706406_1037706413 13 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706413 8:21319158-21319180 CTGGGCTCTAGAACAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037706406 Original CRISPR ATTGTCCTCTACTCTCCATA GGG (reversed) Intergenic
No off target data available for this crispr