ID: 1037706407

View in Genome Browser
Species Human (GRCh38)
Location 8:21319123-21319145
Sequence CATTGTCCTCTACTCTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037706407_1037706415 29 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706415 8:21319175-21319197 GTGGGGGCCAGACATATCAGTGG No data
1037706407_1037706409 -6 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706409 8:21319140-21319162 ACAATGCTTTCACCTTCTCTGGG No data
1037706407_1037706414 13 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706414 8:21319159-21319181 TGGGCTCTAGAACAGTGTGGGGG No data
1037706407_1037706413 12 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706413 8:21319158-21319180 CTGGGCTCTAGAACAGTGTGGGG No data
1037706407_1037706408 -7 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706408 8:21319139-21319161 GACAATGCTTTCACCTTCTCTGG No data
1037706407_1037706412 11 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706412 8:21319157-21319179 TCTGGGCTCTAGAACAGTGTGGG No data
1037706407_1037706416 30 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706416 8:21319176-21319198 TGGGGGCCAGACATATCAGTGGG No data
1037706407_1037706411 10 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706411 8:21319156-21319178 CTCTGGGCTCTAGAACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037706407 Original CRISPR CATTGTCCTCTACTCTCCAT AGG (reversed) Intergenic
No off target data available for this crispr