ID: 1037706414

View in Genome Browser
Species Human (GRCh38)
Location 8:21319159-21319181
Sequence TGGGCTCTAGAACAGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037706407_1037706414 13 Left 1037706407 8:21319123-21319145 CCTATGGAGAGTAGAGGACAATG No data
Right 1037706414 8:21319159-21319181 TGGGCTCTAGAACAGTGTGGGGG No data
1037706406_1037706414 14 Left 1037706406 8:21319122-21319144 CCCTATGGAGAGTAGAGGACAAT No data
Right 1037706414 8:21319159-21319181 TGGGCTCTAGAACAGTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037706414 Original CRISPR TGGGCTCTAGAACAGTGTGG GGG Intergenic
No off target data available for this crispr