ID: 1037709372

View in Genome Browser
Species Human (GRCh38)
Location 8:21343437-21343459
Sequence CTTCAACCCATGTTTCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037709372_1037709377 29 Left 1037709372 8:21343437-21343459 CCACTAAGAAACATGGGTTGAAG No data
Right 1037709377 8:21343489-21343511 TTACTCCCCTCTCCCTTTCTAGG No data
1037709372_1037709374 1 Left 1037709372 8:21343437-21343459 CCACTAAGAAACATGGGTTGAAG No data
Right 1037709374 8:21343461-21343483 CTAATCACTGTCCCTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037709372 Original CRISPR CTTCAACCCATGTTTCTTAG TGG (reversed) Intergenic
No off target data available for this crispr