ID: 1037709375

View in Genome Browser
Species Human (GRCh38)
Location 8:21343472-21343494
Sequence GAGTAATTTTACCAGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037709375_1037709377 -6 Left 1037709375 8:21343472-21343494 CCCTTGTTCTGGTAAAATTACTC No data
Right 1037709377 8:21343489-21343511 TTACTCCCCTCTCCCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037709375 Original CRISPR GAGTAATTTTACCAGAACAA GGG (reversed) Intergenic
No off target data available for this crispr