ID: 1037709471

View in Genome Browser
Species Human (GRCh38)
Location 8:21344023-21344045
Sequence TTTGCTCTGGTCTGAAGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037709471_1037709476 15 Left 1037709471 8:21344023-21344045 CCCGTGCTTCAGACCAGAGCAAA No data
Right 1037709476 8:21344061-21344083 GAAGCTTTATTTGAGCCCACTGG No data
1037709471_1037709477 16 Left 1037709471 8:21344023-21344045 CCCGTGCTTCAGACCAGAGCAAA No data
Right 1037709477 8:21344062-21344084 AAGCTTTATTTGAGCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037709471 Original CRISPR TTTGCTCTGGTCTGAAGCAC GGG (reversed) Intergenic
No off target data available for this crispr