ID: 1037709576

View in Genome Browser
Species Human (GRCh38)
Location 8:21345098-21345120
Sequence TAACGCAAGGTTCTCAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037709576_1037709580 0 Left 1037709576 8:21345098-21345120 CCATCTCTGAGAACCTTGCGTTA No data
Right 1037709580 8:21345121-21345143 AGAAACAGAGGGCGCACACCTGG No data
1037709576_1037709581 1 Left 1037709576 8:21345098-21345120 CCATCTCTGAGAACCTTGCGTTA No data
Right 1037709581 8:21345122-21345144 GAAACAGAGGGCGCACACCTGGG No data
1037709576_1037709582 7 Left 1037709576 8:21345098-21345120 CCATCTCTGAGAACCTTGCGTTA No data
Right 1037709582 8:21345128-21345150 GAGGGCGCACACCTGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037709576 Original CRISPR TAACGCAAGGTTCTCAGAGA TGG (reversed) Intergenic
No off target data available for this crispr