ID: 1037709582

View in Genome Browser
Species Human (GRCh38)
Location 8:21345128-21345150
Sequence GAGGGCGCACACCTGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037709576_1037709582 7 Left 1037709576 8:21345098-21345120 CCATCTCTGAGAACCTTGCGTTA No data
Right 1037709582 8:21345128-21345150 GAGGGCGCACACCTGGGCCCTGG No data
1037709579_1037709582 -6 Left 1037709579 8:21345111-21345133 CCTTGCGTTAAGAAACAGAGGGC No data
Right 1037709582 8:21345128-21345150 GAGGGCGCACACCTGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037709582 Original CRISPR GAGGGCGCACACCTGGGCCC TGG Intergenic
No off target data available for this crispr