ID: 1037710313

View in Genome Browser
Species Human (GRCh38)
Location 8:21350351-21350373
Sequence GACTCAGCTGTGAGTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037710305_1037710313 12 Left 1037710305 8:21350316-21350338 CCCGGTGAAAGAGCCCTGTCTCA No data
Right 1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG No data
1037710310_1037710313 -1 Left 1037710310 8:21350329-21350351 CCCTGTCTCAGCGGGGATGAAGG No data
Right 1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG No data
1037710304_1037710313 19 Left 1037710304 8:21350309-21350331 CCGCTGACCCGGTGAAAGAGCCC No data
Right 1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG No data
1037710306_1037710313 11 Left 1037710306 8:21350317-21350339 CCGGTGAAAGAGCCCTGTCTCAG No data
Right 1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG No data
1037710312_1037710313 -2 Left 1037710312 8:21350330-21350352 CCTGTCTCAGCGGGGATGAAGGA No data
Right 1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037710313 Original CRISPR GACTCAGCTGTGAGTACAGC AGG Intergenic
No off target data available for this crispr