ID: 1037711222

View in Genome Browser
Species Human (GRCh38)
Location 8:21356935-21356957
Sequence TAATTCCCACACATTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8889
Summary {0: 5, 1: 91, 2: 975, 3: 2875, 4: 4943}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037711222_1037711231 12 Left 1037711222 8:21356935-21356957 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1037711231 8:21356970-21356992 TTCAAGATGAGATATGGGTGGGG 0: 66
1: 7879
2: 11361
3: 9513
4: 7127
1037711222_1037711227 6 Left 1037711222 8:21356935-21356957 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1037711227 8:21356964-21356986 CTACAATTCAAGATGAGATATGG 0: 39
1: 4250
2: 7406
3: 9085
4: 9114
1037711222_1037711230 11 Left 1037711222 8:21356935-21356957 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1037711230 8:21356969-21356991 ATTCAAGATGAGATATGGGTGGG 0: 80
1: 7876
2: 11121
3: 10187
4: 7728
1037711222_1037711229 10 Left 1037711222 8:21356935-21356957 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1037711229 8:21356968-21356990 AATTCAAGATGAGATATGGGTGG 0: 80
1: 7907
2: 11382
3: 9623
4: 8575
1037711222_1037711228 7 Left 1037711222 8:21356935-21356957 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1037711228 8:21356965-21356987 TACAATTCAAGATGAGATATGGG 0: 63
1: 7169
2: 10614
3: 9466
4: 7883

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037711222 Original CRISPR TAATTCCCACACATTGTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr