ID: 1037714224

View in Genome Browser
Species Human (GRCh38)
Location 8:21383381-21383403
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037714224_1037714229 -1 Left 1037714224 8:21383381-21383403 CCTGATTTTAATAGAGATCCCCA No data
Right 1037714229 8:21383403-21383425 AGGAATTTTCTTGTCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037714224 Original CRISPR TGGGGATCTCTATTAAAATC AGG (reversed) Intergenic
No off target data available for this crispr